Science Homework Help
Albany State University Double Stranded DNA Virus Questions
Here are the questions to answer for each virus: 5’ TCCGCTATGTTCCTCATTGTCTGATATG 3’
3’ AGGCGATACAAGGAGTAACAGACTATAC 5’ : Double Stranded DNA virus
*the highlighted region is Double Stranded DNA virus
Part 1: Production of viral proteins:
1. Write down any nucleic acid intermediate(s) that must be produced prior to translation of the highlighted region; if no nucleic acid intermediates are produced, write “none”. Make certain you accurately label the ends of the nucleic acids.
2. Can the host cell make the nucleic acid intermediates that were necessary in number one? (write yes or no for each) If you had none then write “NA”.
3. Write down the sequence of the polypeptide chain encoded by that highlighted region.
4. Write down any intermediate(s) produced in the replication of this viral genome; if no nucleic acid intermediates are produced, write “none”. Make sure to accurately label the ends of the sequences.
5. Can the host cell make the nucleic acid intermediates that were necessary in number 4? (write yes or no for each) If you had none then write “NA”.
6. Write down the final sequence of the viral genome that will be placed in the progeny virion. Make sure you accurately label the ends of the sequences.
7. Write the name of a virus that matches this virus type that causes disease in humans.