Science Homework Help
Georgia Military College DNA Sequence and Gene Regulation Discussion
- Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence:
AGTAAACGTACCTGAGACGGG - Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
Talk to us support@bestqualitywriters.com